Sequence ID | >SRA1014698 |
Genome ID | SRR023845.269427 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 224 |
End posion on genome | 148 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gggcacgttt |
tRNA gene sequence |
GGGCCGGTAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGTAGGTTCAAC |
Downstream region at tRNA end position |
tatagacggg |
Secondary structure (Cloverleaf model) | >SRA1014698 Ile GAT t ACCA tatagacggg G - C G - C G - C C - G C - G G - C G + T T C T C A T C C A G G A A | | | | | A T C T C G G T A G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |