Sequence ID | >SRA1014765 |
Genome ID | SRR023845.304271 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 274 |
End posion on genome | 199 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
nnnnncgcga |
tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGTAGAGCGCCACGTTTACACCGTGGATGTCATCGGTTCGAGC |
Downstream region at tRNA end position |
agcaaaagcc |
Secondary structure (Cloverleaf model) | >SRA1014765 Val TAC a ACAA agcaaaagcc G - C G - C G - C C - G C - G T + G T - A C G T T G G C C A T G A A | + | | | G T C T C G A T C G G C G | | | | T T G G A G C T A G ATGTC C - G C - G A - T C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |