Sequence ID | >SRA1014770 |
Genome ID | SRR023845.307508 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 30 |
End posion on genome | 106 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
caccagtttg |
tRNA gene sequence |
GCCCCTGTAGCGCAGTTGGTTAGCGCGCCGCCCTGTCACGGCGGAGGTCGCCGGTTCAAG |
Downstream region at tRNA end position |
aggcgagtca |
Secondary structure (Cloverleaf model) | >SRA1014770 Asp GTC g GCCA aggcgagtca G - C C T C - G C - G C - G T - A G - C T G T T G G C C A T G A A + | | | | A T C G C G G C C G G C G | | | | T T G G C G C T T A G AGGTC C - G C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |