Sequence ID | >SRA1014777 |
Genome ID | SRR023845.309857 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 96 |
End posion on genome | 184 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cacttgtatt |
tRNA gene sequence |
CCCCAAGTGGCGGAATAGGTAGACGCATTGGACTTAAAATCCAACGGGCTTAATATCCTG |
Downstream region at tRNA end position |
ttttgaaaat |
Secondary structure (Cloverleaf model) | >SRA1014777 Leu TAA t ACCA ttttgaaaat C - G C - G C - G C - G A - T A - T G - C T G T C G G C C A T A A G | | | | | A A G G C G G C C G G C G | | | T T G A C G C T A G A CGGGCTTAATATCCTGT T - A T - A G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |