Sequence ID | >SRA1014817 |
Genome ID | SRR023845.325948 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 277 |
End posion on genome | 203 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
nnnnnnnnnc |
tRNA gene sequence |
GGCGGGGTAGCTCAGTTGGTGAGAGCGCACGACTCATAATCGTGAGGTCGCGGGTTCAAG |
Downstream region at tRNA end position |
cagctcccgg |
Secondary structure (Cloverleaf model) | >SRA1014817 Met CAT c ACgt cagctcccgg G + T G - C C - G G - C G - C G - C G + T C G T C G C C C A T G A A | | | | | A T C T C G G C G G G C G | | | | T T G G A G C T G A G AGGTC C - G A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |