Sequence ID | >SRA1014827 |
Genome ID | SRR023845.332730 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 193 |
End posion on genome | 120 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ttctcctcgc |
tRNA gene sequence |
GCGCCGCTAGCTCAATAGGCAGAGCAGCTGACTCTTAATCAGCGGGTTGGGGGTTCGATT |
Downstream region at tRNA end position |
tacgaatgaa |
Secondary structure (Cloverleaf model) | >SRA1014827 Lys CTT c ACag tacgaatgaa G - C C - G G - C C - G C - G G - C C - G T T T C T C C C A T A A A | + | | | G A C T C G G G G G G C G | | | | T T G G A G C C A A GGGTT G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |