Sequence ID | >SRA1015000 |
Genome ID | SRR023845.418172 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 118 |
End posion on genome | 42 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tccagcggtg |
tRNA gene sequence |
GCCCCTATAGCCCAATTGGCAGAGGCAGCGGACTTAAAATCCGCACAGTGTCGGTTCGAG |
Downstream region at tRNA end position |
tatttccgca |
Secondary structure (Cloverleaf model) | >SRA1015000 Leu TAA g ACCA tatttccgca G - C C - G C - G C - G C - G T + G A - T T G T C A G C C A T A A A | | | | | G T C C C G G T C G G C G | | | T T G A G G C C A G A ACAGT G - C C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |