Sequence ID | >SRA1015021 |
Genome ID | SRR023845.424782 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 250 |
End posion on genome | 179 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gaggcgccgc |
tRNA gene sequence |
GCGAGTGTAGTTCAATGGTAGAACTTCAGCTTCCCAAGCTGATAGCGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ttgttctctt |
Secondary structure (Cloverleaf model) | >SRA1015021 Gly CCC c TCtc ttgttctctt G - C C - G G - C A - T G - C T - A G - C T T T T G C C C A A A A + | | | | G T C T T G G C G G G C G | | | | T T G G A A C T A T TAGC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |