Sequence ID | >SRA1015035 |
Genome ID | SRR023845.428195 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 148 |
End posion on genome | 58 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agggcttcgc |
tRNA gene sequence |
GGAGCGGTGGATGAGCGGTTTAAGTCGCACGCCTGGAAAGCGTGTGAGGGTTAACAGCCC |
Downstream region at tRNA end position |
agtcagtcca |
Secondary structure (Cloverleaf model) | >SRA1015035 Ser GGA c GCCA agtcagtcca G - C G - C A - T G - C C - G G + T G - C T A T C G C C C A C G A G | | | | | G G G T A G G C G G G C G + | | T T T A G T C T T A G TGAGGGTTAACAGCCCTCC C - G A - T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |