Sequence ID | >SRA1015050 |
Genome ID | SRR023845.436617 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 33 |
End posion on genome | 108 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
acccgagagg |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGTAGAGCGTCTCGTTTACACCGAGAATGTCGGCGGTTCGAGC |
Downstream region at tRNA end position |
tccccgcatt |
Secondary structure (Cloverleaf model) | >SRA1015050 Val TAC g ACCA tccccgcatt G - C G - C G - C C - G G - C A - T T - A C G T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A G ATGTC T - A C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |