Sequence ID | >SRA1015068 |
Genome ID | SRR023845.446639 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 190 |
End posion on genome | 114 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aacaagtaat |
tRNA gene sequence |
CGGGAAGTGGCTCAGTTTGGTAGAGCATTCGGTTTGGGACCGAAGGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
ttataataat |
Secondary structure (Cloverleaf model) | >SRA1015068 Pro TGG t ACCA ttataataat C - G G - C G - C G - C A - T A - T G - C T A T T G T C C A T G A G + | | | | A T C T C G G C A G G C T | | | | T T G G A G C G T A A GGGTC T - A T - A C - G G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |