Sequence ID | >SRA1015108 |
Genome ID | SRR023845.463803 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 73 |
End posion on genome | -1 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcacggcgat |
tRNA gene sequence |
GCACCCATAGCTCAGCTGGATAGAGCATCAGACTACGAATCTGAGGGTCGGGCGTTCGAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1015108 Arg ACG t NNnn nnnnnnnnnn G A C - G A - T C - G C - G C - G A - T T A T C T C G C A C G A A | + | | | G T C T C G G G G C G C G | | | | T T G G A G C A T A A GGGTC T - A C - G A - T G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |