Sequence ID | >SRA1015118 |
Genome ID | SRR023845.466372 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 103 |
End posion on genome | 191 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gacgcgggtt |
tRNA gene sequence |
GTCCGAGTGGCGGAATGGCAGACGCGCTAGCTTGAGGTGCTAGTGTCCTATTAACGGACG |
Downstream region at tRNA end position |
aagannnnnn |
Secondary structure (Cloverleaf model) | >SRA1015118 Leu GAG t ACCG aagannnnnn G - C T - A C - G C - G G - C A - T G - C T G T C C C C C A T A A G | | | | | A G G G C G G G G G G C G | | | T T C A C G C A G G TGTCCTATTAACGGACGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |