Sequence ID | >SRA1015169 |
Genome ID | SRR023845.485762 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 216 |
End posion on genome | 140 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
ttttgttatt |
tRNA gene sequence |
CGGAATATAGCTCAGCTGGTTAGAGCACTCCGCTGATAACGGAGAGGTCGTTGGTTCAAG |
Downstream region at tRNA end position |
tataaatatt |
Secondary structure (Cloverleaf model) | >SRA1015169 Ile GAT t ACCA tataaatatt C - G G - C G - C A - T A - T T - A A - T T G T T A A C C A C G A A + | | | | A T C T C G G T T G G C G | | | | T T G G A G C T T A A AGGTC C - G T - A C - G C - G G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |