Sequence ID | >SRA1015204 |
Genome ID | SRR023845.498016 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 12 |
End posion on genome | 99 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tgttgtttac |
tRNA gene sequence |
GGAGGGGTGGCCGAGCGGCTGAAGGCACCGGTCTTGAAAACCGGCGATGGGAAACCATTC |
Downstream region at tRNA end position |
taaacaacac |
Secondary structure (Cloverleaf model) | >SRA1015204 Ser TGA c GCCA taaacaacac G - C G - C A - T G - C G - C G + T G - C T A T C T C T C A C G A G | | | | | G G G C C G G A G A G C G | | | T T C A G G C T G A A CGATGGGAAACCATTC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |