Sequence ID | >SRA1015206 |
Genome ID | SRR023845.498428 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 100 |
End posion on genome | 186 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aaagcggcct |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTTAAAGGCAGCAGACTGTAAATCTGCCGGAGTTTCTCCTACG |
Downstream region at tRNA end position |
ccgccccagc |
Secondary structure (Cloverleaf model) | >SRA1015206 Tyr GTA t ACCA ccgccccagc G - C G - C A - T C - G A - T G - C G - C C A T C A T C C A T G A G | | | | | G G G C C G G T A G G C G | | | T T T A G G C T A A A CGGAGTTTCTCCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |