Sequence ID | >SRA1015282 |
Genome ID | SRR023845.539099 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 125 |
End posion on genome | 36 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
accgaacgct |
tRNA gene sequence |
GGAGGGGTGGCCGAGTGGTTGAAGGCGCACGCCTGGAAAGTGTGTATACGGGAAACCGTA |
Downstream region at tRNA end position |
tcgagctcag |
Secondary structure (Cloverleaf model) | >SRA1015282 Ser GGA t GCCA tcgagctcag G - C G - C A - T G - C G - C G - C G + T T A T C G C C C A T G A G | | | | | G G G C C G G C G G G C G | | | T T T A G G C T G A G TATACGGGAAACCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |