Sequence ID | >SRA1015303 |
Genome ID | SRR023846.9027 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 135 |
End posion on genome | 210 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gctgcaatat |
tRNA gene sequence |
GGCCCGGTAGCTCAGTTGGTAGAGCAGCGGATTGAAAATCCGCGTGTCGTTGGTTCGATT |
Downstream region at tRNA end position |
tctttcttct |
Secondary structure (Cloverleaf model) | >SRA1015303 Phe GAA t ACCA tctttcttct G - C G - C C - G C - G C A G - C G - C T T T C A G C C A T G A A | | + | | G T C T C G G T T G G C G | | | | T T G G A G C T A A GTGTC G - C C - G G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |