Sequence ID | >SRA1015335 |
Genome ID | SRR023846.21796 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 146 |
End posion on genome | 221 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tgaggcttgt |
tRNA gene sequence |
TCCTCGATAGCTCAGTTGGTAGAGCGCCGGACTGTTAATCCGTAGGTCCCTGGTTCGAGC |
Downstream region at tRNA end position |
ctacaagccg |
Secondary structure (Cloverleaf model) | >SRA1015335 Asn GTT t GCCA ctacaagccg T - A C - G C - G T - A C - G G - C A - T C G T G G A C C A T G A A | | | | | G T C T C G C C T G G C G | | | | T T G G A G C T A G AGGTC C T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |