Sequence ID | >SRA1015360 |
Genome ID | SRR023846.30127 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 195 |
End posion on genome | 120 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
caactttttt |
tRNA gene sequence |
GCGGAAGTAGCTCAATTGGTAGAGCGATAGCCTTCCAAGCTATAGGTTGCGGGTTCGAGA |
Downstream region at tRNA end position |
cagtgagcag |
Secondary structure (Cloverleaf model) | >SRA1015360 Gly TCC t TCTA cagtgagcag G - C C - G G - C G - C A - T A - T G - C A G T T G C C C A T A A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A G AGGTT A - T T - A A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |