Sequence ID | >SRA1015367 |
Genome ID | SRR023846.31583 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 94 |
End posion on genome | 167 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttccgtcgaa |
tRNA gene sequence |
GCTGGGTTGGCTCAGTTGGTAGAGCGTTGGTCTCATAATCCAAAGGTCGTGAGTTCGATC |
Downstream region at tRNA end position |
ttattttgcg |
Secondary structure (Cloverleaf model) | >SRA1015367 Met CAT a ACat ttattttgcg G - C C - G T + G G - C G - C G - C T - A C T T C A C T C A T G A G | | | | | G T C T C G G T G A G C G | | | | T T G G A G C T A G AGGTC T - A T - A G - C G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |