Sequence ID | >SRA1015368 |
Genome ID | SRR023846.31778 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 54 |
End posion on genome | 130 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cgctgcgcct |
tRNA gene sequence |
AGGAGTGTAGCTCAACTGGTCAGAGCGCCGGTCTCCAAAACCGGAGGTTGCGGGTTCGAG |
Downstream region at tRNA end position |
cttggctgct |
Secondary structure (Cloverleaf model) | >SRA1015368 Trp CCA t GCCA cttggctgct A - T G - C G - C A - T G - C T - A G - C T G T C T C C C A C A A A | | | | G T C T C G G C G G G C G | | | | T T G G A G C T C A G AGGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |