Sequence ID | >SRA1015380 |
Genome ID | SRR023846.37613 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 276 |
End posion on genome | 200 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggccgagccc |
tRNA gene sequence |
GCCGCCTTGGCGCAGTCCGGTAGCGCAGTGCTCTTGTAAAGCGAAGGTCGTCGGTTCGAA |
Downstream region at tRNA end position |
ccggccccgt |
Secondary structure (Cloverleaf model) | >SRA1015380 Thr TGT c TCCC ccggccccgt G - C C - G C - G G - C C - G C - G T - A T A T C A G C C A T G A G | | | | | G C C G C G G T C G G C C | | | | T T G G C G C G T A A AGGTC G A T + G G - C C - G T - A C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |