Sequence ID | >SRA1015387 |
Genome ID | SRR023846.39253 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 157 |
End posion on genome | 231 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
caaaaaccct |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCTGGTATCGCGCCAGCATGGGGTGCTGGAGGTCGTAGGTTCGAA |
Downstream region at tRNA end position |
atttagataa |
Secondary structure (Cloverleaf model) | >SRA1015387 Pro GGG t ACtg atttagataa C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A C G A A | + | | | G C T G C G G T A G G C T | | | T T G T C G C G T A G AGGTC C - G C - G A - T G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |