Sequence ID | >SRA1015389 |
Genome ID | SRR023846.40118 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 40 |
End posion on genome | 112 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ataacagata |
tRNA gene sequence |
GGGGGTTTAACTCAGTTGGTAGAGTGAGTGACTTTTAATCACTCCGTCACAGGTTCGAAC |
Downstream region at tRNA end position |
attataacat |
Secondary structure (Cloverleaf model) | >SRA1015389 Lys TTT a Atat attataacat G - C G + T G - C G - C G - C T - A T - A C A T T G T C C A T G A A | | | | | G T C T C A A C A G G C G | | | | T T G G A G T T A G CCGTC A - T G - C T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |