Sequence ID | >SRA1015395 |
Genome ID | SRR023846.42063 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 107 |
End posion on genome | 180 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ccggagaaat |
tRNA gene sequence |
GCGCCTGTAGCTCAACGGATAGAGCATCTGACTACGGATCAGAAGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
aatcgaaagc |
Secondary structure (Cloverleaf model) | >SRA1015395 Arg ACG t ACat aatcgaaagc G - C C - G G - C C - G C - G T - A G - C T G T C T C C C A C A A A | + | | | G G C T C G G G G G G C G | | | | T T A G A G C T A A AGGTT T - A C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |