Sequence ID | >SRA1015408 |
Genome ID | SRR023846.48365 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 82 |
End posion on genome | 156 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tggaatataC |
tRNA gene sequence |
ACCCGTCTAGCTCAGTTGGTAGAGCGCTGGCCTCTTAAGCCAGTGGTCGTGGGTTCGAGC |
Downstream region at tRNA end position |
gcttctttgc |
Secondary structure (Cloverleaf model) | >SRA1015408 Lys CTT C GTtt gcttctttgc A - T C - G C - G C - G G G T + G C - G C G T C A C C C A T G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A G TGGTC C - G T - A G - C G - C C - G C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |