Sequence ID | >SRA1015435 |
Genome ID | SRR023846.56176 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 182 |
End posion on genome | 107 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cgaacccgga |
tRNA gene sequence |
GCCCGGGTAGCTCAGCTGGTAGAGCATGCGATTGAAAATCGCAGTGTCGGCGGTTCGACT |
Downstream region at tRNA end position |
tctccgatta |
Secondary structure (Cloverleaf model) | >SRA1015435 Phe GAA a ACCA tctccgatta G - C C - G C - G C - G G - C G - C G - C T C T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC T - A G - C C - G G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |