Sequence ID | >SRA1015436 |
Genome ID | SRR023846.56192 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 71 |
End posion on genome | 145 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tggttctgcT |
tRNA gene sequence |
GGGCGCATAGCGCAGTGGTAGCGCGTCCGCTTTGCAAGCGGAAGGCCCCGGGTTCAATCC |
Downstream region at tRNA end position |
ctttatgcga |
Secondary structure (Cloverleaf model) | >SRA1015436 Ala TGC T AACt ctttatgcga G - C G - C G + T C - G G + T C - G A - T C T T G G C C C A G A A | | | | | A T C G C G C C G G G C G | | | | T T G G C G C T A G AGGCC T - A C - G C - G G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |