Sequence ID | >SRA1015437 |
Genome ID | SRR023846.56430 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 241 |
End posion on genome | 167 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
nnnnnnntgT |
tRNA gene sequence |
GCACCGTTGGTCTAATGGTTAGGATTCATCCCTTCCAAGGATGAGGTCGGGGTTCGATTC |
Downstream region at tRNA end position |
tttgcgagct |
Secondary structure (Cloverleaf model) | >SRA1015437 Gly TCC T AGCt tttgcgagct G - C C - G A C C - G C - G G - C T - A T T T G C C C C A T A A G | | | | | G G T C T G C G G G G C G + | | + T T T G G A T T A T AGGT C - G A - T T - A C - G C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |