Sequence ID | >SRA1015447 |
Genome ID | SRR023846.62614 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 150 |
End posion on genome | 75 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
atcgacggac |
tRNA gene sequence |
GAGCGCGTAGCTCAGTTGGTAGAGCAACGGACTTTTAATCTGTAGGTCCCGGGTTCGAGC |
Downstream region at tRNA end position |
ataaattcaa |
Secondary structure (Cloverleaf model) | >SRA1015447 Lys TTT c ACCA ataaattcaa G - C A - T G - C C - G G - C C - G G - C C G T G G C C C A T G A A | | | | | G T C T C G C C G G G C G | | | | T T G G A G C T A A AGGTC A - T C - G G + T G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |