Sequence ID | >SRA1015448 |
Genome ID | SRR023846.62794 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 159 |
End posion on genome | 85 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggaaacgcgc |
tRNA gene sequence |
GCCGGATTAGCTCAGCGGTAGAGCAGCGGTTTTGTAAACCGAAGGTCGGGGGTTCAATCC |
Downstream region at tRNA end position |
gctttttctt |
Secondary structure (Cloverleaf model) | >SRA1015448 Thr TGT c ACCG gctttttctt G - C C - G C - G G - C G - C A - T T - A C T T C T C C C A G A A | + | | | A C C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |