Sequence ID | >SRA1015460 |
Genome ID | SRR023846.68247 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 235 |
End posion on genome | 145 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
nnnnntatgc |
tRNA gene sequence |
GGAGCGGTGGCCGAGTGGTCGAAGGCGCTCGCCTGGAAAGTGAGTATACGTCAAAAGCGT |
Downstream region at tRNA end position |
gttacccggg |
Secondary structure (Cloverleaf model) | >SRA1015460 Ser GGA c GCCA gttacccggg G - C G - C A - T G - C C - G G - C G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATACGTCAAAAGCGTATC C - G T - A C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |