Sequence ID | >SRA1015461 |
Genome ID | SRR023846.69393 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 32 |
End posion on genome | 103 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cactcgcaat |
tRNA gene sequence |
TGCCCGATCGTCTAAGGGTAGGACGACAGATTTTGGTTCTGTTTGTGGAGGTTCGAATCC |
Downstream region at tRNA end position |
atacacaaaa |
Secondary structure (Cloverleaf model) | >SRA1015461 Gln TTG t ACag atacacaaaa T - A G - C C - G C - G C - G G - C A - T T A T C T T C C A A A C | + | | | G G T C T G G G A G G C G + | | | T T G G G A C T A G TTGT A - T C - G A - T G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |