Sequence ID | >SRA1015472 |
Genome ID | SRR023846.76466 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 101 |
End posion on genome | 173 |
Amino Acid | Ile |
Anticodon | AAT |
Upstream region at tRNA start position |
ttcgagtgcc |
tRNA gene sequence |
GGTCGTATAGCTCAGTCGGTAGAGCACAGTGCTAATAACGCTGCGGTCCAGGGTTCGAGC |
Downstream region at tRNA end position |
tgccgctttt |
Secondary structure (Cloverleaf model) | >SRA1015472 Ile AAT c Attt tgccgctttt G - C G - C T - A C - G G + T T - A A - T C G T G T C C C A T G A A | | | | | G C C T C G C A G G G C G | | | | T T G G A G C T A A CGGTC C - G A - T G - C T + G G - C C A T A A A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |