Sequence ID | >SRA1015483 |
Genome ID | SRR023846.79777 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 189 |
End posion on genome | 105 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cgtccgctcg |
tRNA gene sequence |
GCGGGCGTGGCGGAACTGGTAGACGCGCTGGATTTAGGTTCCAGTATCGAAAGATGTGGG |
Downstream region at tRNA end position |
gtgacgccgc |
Secondary structure (Cloverleaf model) | >SRA1015483 Leu TAG g ACCA gtgacgccgc G - C C - G G - C G - C G - C C - G G - C T C T T T C C C A C A A G + + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TATCGAAAGATGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |