Sequence ID | >SRA1015499 |
Genome ID | SRR023846.85718 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 239 |
End posion on genome | 165 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
agtacaatca |
tRNA gene sequence |
GCCGTTATAGCTCAGCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCCGGGGTTCAAGTC |
Downstream region at tRNA end position |
gacttcttcg |
Secondary structure (Cloverleaf model) | >SRA1015499 Thr GGT a TCAA gacttcttcg G - C C - G C - G G - C T - A T - A A - T T G T G C C C C A G A A | | | | | A C C T C G C G G G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |