Sequence ID | >SRA1015502 |
Genome ID | SRR023846.86649 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 136 |
End posion on genome | 210 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
acatagtaag |
tRNA gene sequence |
GTGGATATAGTTCAATTGGCAGAACAACTGTATGTGGCACAGTAAGTTCCCTGTTCGATT |
Downstream region at tRNA end position |
tactagtata |
Secondary structure (Cloverleaf model) | >SRA1015502 His GTG g CCAg tactagtata G - C T T G - C G - C A - T T - A A - T T T T G G G A C A T A A A | | | | | G T C T T G C C C T G C G | | | | T T G G A A C C A A AAGTT A - T C - G T - A G - C T - A A C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |