Sequence ID | >SRA1015506 |
Genome ID | SRR023846.88274 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 152 |
End posion on genome | 243 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gccaccgcca |
tRNA gene sequence |
GGAGGGGTGCCGGAGCGGCCGATCGGAAGCGCCTTGAAAGCGCTCGCTGGCAGCGATGTC |
Downstream region at tRNA end position |
atcggacgcc |
Secondary structure (Cloverleaf model) | >SRA1015506 Ser TGA a GCCC atcggacgcc G + T G - C A - T G - C G - C G - C G - C T A T C G C C C A C G A G | | | | | G G G G C C G C G G G C G + | | | T T C T C G G C G A A CGCTGGCAGCGATGTCAGCC A - T G - C C - G G - C C - G C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |