Sequence ID | >SRA1015518 |
Genome ID | SRR023846.93536 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 132 |
End posion on genome | 209 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gaccagtttt |
tRNA gene sequence |
AGGGGAGTCGCCAAGAGGCCTAAGGCACTGGGTTTTGATCCCAGCAATTCGAAGGTTCGA |
Downstream region at tRNA end position |
gctttgattg |
Secondary structure (Cloverleaf model) | >SRA1015518 Gln TTG t GCCA gctttgattg A - T G - C G + T G - C G - C A - T G - C T A T C T T C C A A G A C | | | | | G G A C C G G A A G G C G | | | T T C A G G C C T A A CAATTC C - G T - A G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |