Sequence ID | >SRA1015519 |
Genome ID | SRR023846.94026 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 93 |
End posion on genome | 166 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaccacacac |
tRNA gene sequence |
GGTGGCGTGGCCGAGCGGCTAGGCACCGGCCTGCAAAGCCGTTTACACGGGTTCGAATCC |
Downstream region at tRNA end position |
ctcacaacag |
Secondary structure (Cloverleaf model) | >SRA1015519 Cys GCA c TCAA ctcacaacag G - C G - C T - A G - C G - C C - G G - C T A T T G C C C A G A G | | | | | G C G C C G A C G G G C G | | | T T G A G G C C T A TTAC C T C - G G - C G - C C - G C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |