Sequence ID | >SRA1015520 |
Genome ID | SRR023846.94131 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 129 |
End posion on genome | 41 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cctctccggc |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCTCGCTTGGAAAGCGGGTTGGGTTAACAGCCCT |
Downstream region at tRNA end position |
ctccgctctg |
Secondary structure (Cloverleaf model) | >SRA1015520 Ser GGA c GCCG ctccgctctg G - C G - C A - T G - C G - C A - T T - A T A T T C C C C A T G A C | | | | | G G T C C G A G G G G C G | | | T T C T G G C C T A G TTGGGTTAACAGCCCTC C - G T + G C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |