Sequence ID | >SRA1015578 |
Genome ID | SRR023846.117430 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 181 |
End posion on genome | 108 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ccgtagatgc |
tRNA gene sequence |
TGGGGAATAGTTTAAGGGTAGAACAGCGGACTCTGACTCCGCTAGTCTTGGTTCGAATCC |
Downstream region at tRNA end position |
gcatacaaca |
Secondary structure (Cloverleaf model) | >SRA1015578 Gln CTG c GCCA gcatacaaca T - A G - C G - C G - C G - C A - T A - T T A T G G A C C A A A A | + | | | G G T T T G C T T G G C G + | | | T T G G A A C T A A TAGT G - C C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |