Sequence ID | >SRA1015665 |
Genome ID | SRR023846.151055 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 231 |
End posion on genome | 304 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gcccgcgcgt |
tRNA gene sequence |
TGGGGAATAGGTTAACGGTAGACCCACGGACTCTGACTCCGTTAGTCCTGGTTCGAATCC |
Downstream region at tRNA end position |
gctctctcat |
Secondary structure (Cloverleaf model) | >SRA1015665 Gln CTG t GCCA gctctctcat T - A G - C G - C G - C G - C A - T A - T T A T G G A C C A A A A | | | | | G C T T G G C C T G G C G + | | | T T G G A C C T A C TAGT A - T C - G G - C G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |