Sequence ID | >SRA1015682 |
Genome ID | SRR023846.157732 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 185 |
End posion on genome | 101 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ggcgttcatc |
tRNA gene sequence |
GCGGGCGTGGTGGAATTGGTAGACGCGCCGGACTCAAAATCCGGTTCCGCAAGGAGTGTC |
Downstream region at tRNA end position |
tcgtcacgct |
Secondary structure (Cloverleaf model) | >SRA1015682 Leu CAA c ACCA tcgtcacgct G - C C - G G - C G - C G - C C - G G - C T T T C A G C C A T A A G | | | | | G T G G T G G T C G G C G | + | T T G A C G C T A G G TTCCGCAAGGAGT C - G C - G G - C G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |