Sequence ID | >SRA1015745 |
Genome ID | SRR023846.178860 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 201 |
End posion on genome | 126 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gccccggaat |
tRNA gene sequence |
GGACGCATAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGTCCTTGGTTCGAGC |
Downstream region at tRNA end position |
cctccaccgc |
Secondary structure (Cloverleaf model) | >SRA1015745 Lys CTT t ACCA cctccaccgc G - C G - C A - T C - G G - C C - G A - T C G T G A A C C A T G A A | | | | | G T C T C G C T T G G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |