Sequence ID | >SRA1015747 |
Genome ID | SRR023846.180121 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 96 |
End posion on genome | 21 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aaccgggtgc |
tRNA gene sequence |
GAGCGCGTAGCTCAGTTGGTAGAGCAACGGACTTTTAATCTGTAGGTCCTGGGTTCGAGT |
Downstream region at tRNA end position |
caaaatcaac |
Secondary structure (Cloverleaf model) | >SRA1015747 Lys TTT c ACCA caaaatcaac G - C A - T G - C C - G G - C C - G G - C T G T G A C C C A T G A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A AGGTC A - T C - G G + T G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |