Sequence ID | >SRA1015769 |
Genome ID | SRR023846.192203 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 122 |
End posion on genome | 47 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
cgcaaggcga |
tRNA gene sequence |
GGGTGCATAGCTCAGTTGGTAGAGCAGCTGACTCTTAATCAGCGGGTCCAAGGTTCGAAC |
Downstream region at tRNA end position |
tttaagccgc |
Secondary structure (Cloverleaf model) | >SRA1015769 Lys CTT a ACCA tttaagccgc G - C G - C G - C T - A G - C C - G A - T C A T G T T C C A T G A A | | | | | G T C T C G C A A G G C G | | | | T T G G A G C T A A GGGTC G - C C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |