Sequence ID | >SRA1015801 |
Genome ID | SRR023846.205074 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 20 |
End posion on genome | 104 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
agtctgaaat |
tRNA gene sequence |
GCGGATGTGGTGGAATTGGTAGACACACTGGATTTAGGTTCCAGCGCCGCAAGGTGTGAG |
Downstream region at tRNA end position |
gatgtgcttt |
Secondary structure (Cloverleaf model) | >SRA1015801 Leu TAG t ACCA gatgtgcttt G - C C - G G - C G - C A - T T + G G - C T G T C T C T C A T A A G | | | | | G T G G T G G A G A G C G | | | T T G A C A C T A G A CGCCGCAAGGTGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |