Sequence ID | >SRA1015805 |
Genome ID | SRR023846.206796 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 185 |
End posion on genome | 258 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gccgcagcaa |
tRNA gene sequence |
CGGGGTGTGGCGCAGCTTGGTAGCGCGCCTCGTTCGGGACGAGGAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1015805 Pro CGG a Annn nnnnnnnnnn C - G G - C G - C G - C G - C T - A G - C T A T T G T C C A C G A G + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A G AGGTC C - G C - G T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |